NCERT SOLUTIONS FOR CLASS 12 BIOLOGY

NCERT Solutions for Class 12th Biology is provided here. Students can download the complete NCERT solutions for Class 12th Biology in the full PDF format. This page provides a complete solution for all Chapters of Class 12th Biology. Download the NCERT Solutions for Class 12th Biology for free in this page. Get the solutions for all individual chapters and exercises of Class 12th Biology. Are you studying Class 12th? Looking for the NCERT Solutions for Class 12th Biology? If yes, you have come to the right place. CBSE students who are studying Class 12th Biology can get the Class 12th Biology Solutions here.

Last modified:2019-10-17

 

These are the chapters which are involved in the 12th Biology:

Chapter 1 : Reproduction in Organism

Chapter 2 : Sexual Reproduction in Flowering Plants

Chapter 3 : Human Reproduction

Chapter 4 : Reproductive Health

Chapter 5 : Principles of Inheritance and variation

Chapter 6 : Molecular Basis of Inheritance

Chapter 7 : Evolution

Chapter 8 : Human Health and Disease

Chapter 9 : Strategies for Enhancement in Food Production

Chapter 10: Microbes in Human Welfare

Chapter 11: Biotechnology - Principles and processes

Chapter 12: Biotechnology and its technology

Chapter 13: Organisms and Population

Chapter 14: Eco system

Chapter 15 : Business and Conservation

Chapter 16 : Environmental Issues

 

Chapter 1 : Reproduction in Organism

Question : Why is reproduction essential for organisms? 

Solution : Reproduction is a fundamental feature of all living organisms. It is a biological process through which living organisms produce offspring similar to them. Reproduction ensures the continuance of various species on the Earth. In the absence of reproduction, the species will not be able to exist for a long time and may soon become extinct. 

 

Question: Which is a better mode of reproduction sexual or asexual? Why? 

Solution: Sexual reproduction is a better mode of reproduction. It allows the formation of new variants by the combination of the DNA from two different individuals, typically one of each sex. It involves the fusion of the male and the female gametes to produce zygotes, which are not exactly identical to either one of their parents. This variation allows the individual to adapt to constantly changing and challenging environments. Also, it leads to the evolution of better suited organisms which ensures greater survival of the species. On the contrary, asexual reproduction allows very little or no variation at all. As a result, the individuals produced are exact copies of their parents and themselves.

 

Question: Why is the offspring formed by asexual reproduction referred to as clone? 

Solution : A clone is a group of morphologically and genetically identical individuals. In the process of asexual reproduction, only one parent is involved and there is no fusion of the male and the female gamete. As a result, the offspring produced are morphologically and genetically similar to their parents and are thus, called clones.

 

Question : Offspring formed due to sexual reproduction have better chances of survival. Why? Is this statement always true? 

Solution : Sexual reproduction involves the fusion of the male and the female gamete. This fusion allows the formation of new variants by the combination of the DNA from two (usually) different members of the species. The variations allow individuals to adapt under varied environmental conditions for better chances of survival. However, it is not always necessary that the offspring produced due to sexual reproduction has better chances of survival. Some variants produced may actually be less suited for survival. Also, under some circumstances, asexual reproduction is more advantageous for certain organisms. For example, some individuals who do not move from one place to another and are well settled in their environment. 

 

Question: Define (a) Juvenile phase, (b) Reproductive phase, (c) Senescent phase. 

Solution:  (a) Juvenile phase: It is the period of growth in an individual organism after its birth and before it reaches reproductive maturity. It is also called as vegetative phase. (b) Reproductive phase: It is the period when an individual organism is capable of reproducing sexually. In this phase the reproductive system is mature and produces gametes that can then fertilize to form the zygote. (c) Senescent phase: It is the period when an organism grows old and loses the ability to reproduce. The aging of tissues and organs starts to take place leading to progressive deterioration of the body.

 

Question: Higher organisms have resorted to sexual reproduction in spite of its complexity. Why? 

Solution: Although sexual reproduction involves more time and energy, higher organisms have resorted to sexual reproduction in spite of its complexity. This is because this mode of reproduction helps introduce new variations in the progeny through the combination of the DNA from two (usually) different individuals. These variations allow the individual to cope with various environmental conditions and thus, make the organism better suited for the environment. Variations also lead to the evolution of better organisms and therefore, provide better chances of survival. On the other hand, asexual reproduction does not provide genetic differences in the individuals produced. Therefore, such individuals are more susceptible to changes in the environment. The lack of variation ensures that successive generations are identical genetically and is therefore less likely to contribute to evolution. 

 

Question: Explain why meiosis and gametogenesis are always interlinked? 

Solution: Meiosis is a process of reductional division in which the amount of genetic material is reduced. Gametogenesis is the process of the formation of gametes. Gametes produced by organisms are haploids (containing only one set of chromosomes), while the body of an organism is diploid. Therefore, for producing haploid gametes (gametogenesis), the germ cells of an organism undergo meiosis. During the process, the meiocytes of an organism undergo two successive nuclear and cell divisions with a single cycle of DNA replication to form the haploid gametes.

 

Question: Define external fertilization. Mention its disadvantages. 

Solution: External fertilization is the process in which the fusion of the male and the female gamete takes place outside the female body in an external medium, generally water. Fish, frog, starfish are some organisms that exhibit external fertilization. Disadvantages of external fertilization: In external fertilization, eggs have less chances of fertilization. This can lead to wastage of a large number of eggs produced during the process. Therefore, large numbers of eggs will need to be produced by the female to account for the wastage of the eggs in water. This requires more energy. Further, there is an absence of proper parental care of the offspring, which results in a low rate of survival in the progenies.

 

Question: Describe the post-fertilization changes in a flower. 

Solution: Fertilization is the process of the fusion of the male and the female gametes to form a diploid zygote. After fertilization, the zygote divides several times to form an embryo. The fertilized ovule forms a seed. The seed contains an embryo, enclosed in a protective covering, called the seed coat. As the seed grows further, other floral parts wither and fall off. This leads to the growth of the ovary, which enlarges and ripens to become a fruit with a thick wall called the pericarp.

 

Question: What is bisexual flower? Collect five bisexual flowers from your neighbourhood and with the help of your teacher find out their common and scientific names. 

Solution : A flower that contains both the male and female reproductive structure (stamen and pistil) is called a bisexual flower. Examples of plants bearing bisexual flowers are: (1) Water lily (Nymphaea odorata) (2) Rose (Rosa multiflora) (3) Hibiscus (Hibiscus rosa-sinensis) (4) Mustard (Brassica nigra) (5) Petunia (Petunia hybrida).

 

Question: Why are offspring of oviparous animals at a greater risk as compared to offspring of viviparous animals? 

Solution : Oviparous animals lay eggs outside their bodies. As a result, the eggs of these animals are under continuous threat from various environmental factors. On the other hand, in viviparous animals, the development of the egg takes place inside the body of the female. This keeps the embryo or foetus safe from the predators. Hence, the offspring of an egg-laying or oviparous animal is at greater risk as compared to the offspring of a viviparous animal, which gives birth to its young ones.

 

Chapter 2 : Sexual Reproduction in Plants

 

Question : Name the parts of an angiosperm flower in which development of male and female gametophytes take place. 

Solution : Development of male gametophyte (microgametogenesis) occurs in pollen sac of anther up to 2-celled stage. The female gametophyte develops (megagametogenesis) in the nucellus of ovules.

 

Question: Mention two strategies evolved to prevent self-pollination in flowers.

Solution: Continued self-pollination decreases the vigour and vitality of a particular race. Thus, flowering plants have developed many devices to discourage self-pollination and to encourage cross-pollination. Dichogamy and self-sterility are two most common devices that ensure cross-pollination. Dichogamy- Maturation of anther and stigma at different times in a bisexual flower prevent self-pollination. Self-sterility (or self-incompatibility) – Due to the presence of self-sterile gene in some flowers, pollen grains do not germinate on the stigma of flowers. e.g., - tobacco, potato

 

Question: What is self-incompatibility? Why does self-pollination not lead to seed formation in selfin compatible species? 

Solution : When the pollen grains of an anther do not germinate on the stigma of the same flower, then such a flower is called self-sterile or incompatible and such condition is known as selfin compatibility or self-sterility. The transference of pollen grains shed from the anther to the stigma of the pistil is called pollination. This transference initiates the process of seed formation. Self-pollination is the transfer of pollen grain shed from the anther to the stigma of the pistil in the same flower. But in some flower self-pollination does not lead to the formation of seed  because of the presence of the same sterile gene on pistil and pollen grain. The pollen grain is unable to germinate and therefore the egg cell will not be fertilized by the male gamete. Thus, the ovule does not develop into a seed.

 

Question : What is bagging technique? How is it useful in a plant breeding programme? 

Solution : It is the covering of emasculated flowers (removal of anthers in bud condition from a bisexual flower by a bag of butter paper of polythene in their bud condition i.e., before anthesis) to prevent contamination of its stigmas by unwanted pollen. When the stigmas of emasculated flowers mature, the bags are removed, stigmas are dusted with pollen grains of desired male plants by means of a pre-sterilized brush and flowers are re-bagged till fruits develop. This technique is mainly used in artificial hybridization. Plant breeders often use this technique to prevent the contamination of stigma of the flowers from unwanted pollen grains.

 

Question: What is triple fusion? Where and how does it take place? Name the nuclei involved in triple fusion.

Solution : Fusion of second male gamete with the two polar nuclei located in the central cell to form the triploid primary endosperm nucleus (PEN) is called triple fusion or vegetative fertilization. This process takes place in the embryo sac. After reaching the ovary, pollen tube enters into the embryo sac from the micropylar end. After penetration, the tip of the pollen tube ruptures releasing the two male gametes. The one male gamete fuses with the egg to form the diploid zygote. This process is called syngamy and the other male gamete fuses with the two polar nuclei to form the triploid primary endosperm and this process is known as triple fusion. These two events of fertilization constitute the process of double fertilization.

 

Question : Do you think the zygote is dormant for sometimes in a fertilized ovule?

Solution : The zygote after a period of rest develops into an embryo. Most zygotes remain dormant until a certain amount of endosperm forms. They do so, to provide assured nutrition to the developing embryo.

 

Question : Why is apple called a false fruit? Which part(s) of the flower forms the fruit? 

Solution : Botanically ripened ovary is called a true fruit. The fruits in which thalamus and other floral parts develop along with the ovary are called false fruits. For example – apple, strawberry, cashew etc. In apple the main edible portion of the fruit is the fleshy thalamus. Ovary forms the fruit after the fertilization or without fertilization in parthenocarpic fruits. 

 

Question : What is meant by emasculation? When and why does a plant breeder employ this technique?

Solution: Emasculation is the removal of stamens mainly the anthers from the flower buds before their dehiscence. This is mainly done to avoid self-pollination. Emasculation is one of the measures in the artificial hybridization. Plant breeders employed this technique to prevent the pollination within the same flower or to pollinate stigmas with pollen of desired variety.

 

Question : If one can induced parthenocarpy through the application of growth substances, which fruits would you select to induce parthenocarpy and why?

Solution: Parthenocarpic fruits are seedless. They develop from ovary without fertilization. Banana, grapes, oranges, Pineapple, Guava, Watermelon, lemon are selected because these seedless units are of high economic importance. The fruits in which seeds or seed part form edible portion (e.g., Pomegranate) are not selected to induce parthenocarpy.

 

Chapter 3 : Human Reproduction

Fill in the blanks:

(a) Humans reproduce __________. (asexually/sexually)

(b) Humans are__________. (oviparous/viviparous/ovoviviparous)

(c) Fertilization is __________ in humans. (external/internal)

(d) Male and female gametes are __________. (diploid/haploid)

(e) Zygote is __________. (diploid/haploid)

(f) The process of the release of ovum from a mature follicle is called__________.

(g) Ovulation is induced by a hormone called the __________.

(h) The fusion of the male and the female gamete is called __________.

(i) Fertilization takes place in the __________.

(j) The zygote divides to form __________, which is implanted in the uterus.

(k) The structure which provides vascular connection between the foetus and uterus is called 

 

Answer:

Solution : (a) Humans reproduce sexually. (b) Humans are viviparous. (c) Fertilization is internal in humans. (d) Male and female gametes are haploid. (e) Zygote is diploid. (f) The process of release of the ovum from a mature follicle is called ovulation. (g) Ovulation is induced by a hormone called luteinizing hormone. (h) The fusion of the male and the female gametes is called fertilization. (i) Fertilization takes place in the fallopian tube. (j) The zygote divides to form a blastocyst, which is implanted in the uterus. (k) The structure which provides vascular connection between the foetus and uterus is called placenta.

 

Question : Describe the structure of a seminiferous tubule. 

Solution : The production of sperm in the testes takes place in a highly coiled structure called the seminiferous tubules. These tubules are located in the testicular lobules. Each seminiferous tubule is lined by germinal epithelium. It is lined on its inner side by two types of cells namely spermatogonia and Sertoli cells respectively. Spermatogonia are male germ cells which produce primary spermatocytes by meiotic divisions. Primary spermatocytes undergo further meiotic division to form secondary spermatocytes and spermatids. Spermatids later metamorphoses into male gametes called spermatozoa. Sertoli cells are known as nurse cells of the testes as they provide nourishment to the germ cells. There are large polygonal cells known as interstitial cells or Leydig cells just adjacent to seminiferous tubules. These cells secrete the male hormone called testosterone. 

 

Question: What is spermatogenesis? Briefly describe the process. 

Solution : Spermatogenesis is the process of the production of sperms from the immature germ cells in males. It takes place in seminiferous tubules present inside the testes. During spermatogenesis, a diploid spermatogonium (male germ cell) increases its size to form a diploid primary spermatocyte. This diploid primary spermatocyte undergoes first meiotic division (meiosis I), which is a reductional division to form two equal haploid secondary spermatocytes. Each secondary spermatocyte then undergoes the second meiotic division (meiosis II) to form two equal haploid spermatids. Hence, a diploid spermatogonium produces four haploid spermatids. These spermatids are transformed into spermatozoa (sperm) by a process called spermatogenesis.

 

Question: Name the hormones involved in the regulation of spermatogenesis. 

Solution : Follicle-stimulating hormones (FSH) and luteinizing hormones (LH) are secreted by gonadotropin-releasing hormones from the hypothalamus .These hormones are involved in the regulation of the process of spermatogenesis. FSH acts on Sertoli cells, whereas LH acts on Leydig cells of the testis and stimulates the process of spermatogenesis.

 

Question: Define spermiogenesis and spermiation. 

Solution : Spermiogenesis is the process of transforming spermatids into mature spermatozoa or sperms. Spermiation is the process when mature spermatozoa are released from the Sertoli cells into the lumen of seminiferous tubules.

 

Question: What are the major components of seminal plasma? 

Solution : Semen (produced in males) is composed of sperm and seminal plasma. The major components of the seminal plasma in the male reproductive system are mucus, spermatozoa, and various secretions of accessory glands. The seminal plasma is rich in fructose, calcium, ascorbic acid, and certain enzymes. It provides nourishment and protection to sperms.

 

Question: What are the major functions of male accessory ducts and glands? 

Solution : The male accessory ducts are vasa efferentia, epididymis, vas deferens, and rete testis. They play an important role in the transport and temporary storage of sperms. On the contrary, male accessory glands are seminal vesicles, prostate glands, and bulbourethral glands. These glands secrete fluids that lubricate the reproductive system and sperms. The sperms get dispersed in the fluid which makes their transportation into the female body easier. The fluid is rich in fructose, ascorbic acid, and certain enzymes. They also provide nutrients and activate the sperm.

 

Question: Name the functions of the following. (a) Corpus luteum (b) Endometrium (c) Acrosome (d) Sperm tail (e) Fimbriae 

Solution : (a) Corpus luteum: Corpus luteum is formed from the ruptured Grafiaan follicle. It secretes progesterone hormone during the luteal phase of the menstrual cycle. A high level of progesterone inhibits the secretion of FSH and LH, thereby preventing ovulation. It also allows the endometrium of the uterus to proliferate and to prepare itself for implantation. (b) Endometrium: It is the innermost lining of the uterus. It is rich in glands and undergoes cyclic changes during various phases of the menstrual cycle to prepare itself for the implantation of the embryo. (c) Acrosome: It is a cap-like structure present in the anterior part of the head of the sperm. It contains hyaluronidase enzyme, which hydrolyses the outer membrane of the egg, thereby helping the sperm to penetrate the egg at the time of fertilization. (d) Sperm tail: It is the longest region of the sperm that facilitates the movement of the sperm inside the female reproductive tract.

 

Question: Identify True/False statements. Correct each false statement to make it true. (a) Androgens are produced by Sertoli cells. (True/False) (b) Spermatozoa get nutrition from Sertoli cells. (True/False) (c) Leydig cells are found in the ovary. (True/False) (d) Leydig cells synthesise androgens. (True/False) (e) Oogenesis takes place in corpus luteum. (True/False) (f) Menstrual cycle ceases during pregnancy. (True/False) (g) Presence or absence of hymen is not a reliable indicator of virginity or sexual experience. (True/False)

Solution: 

(a) Androgens are produced by Sertoli cells. (False)

Androgens are produced by Leydig cells found in seminiferous tubules of the testis.

(b) Spermatozoa get nutrition from Sertoli cells. (True)

(c) Leydig cells are found in the ovary. (False)

Leydig cells are found in the seminiferous tubules of the testis.

(d) Leydig cells synthesise androgens. (True)

(e) Oogenesis takes place in corpus luteum. (False)

Oogenesis takes place in the ovary.

(f) Menstrual cycle ceases during pregnancy. (True)

(g) Presence or absence of the hymen is not a reliable indicator of virginity or sexual

experience. (True)

 

Question : What is menstrual cycle? Which hormones regulate menstrual cycle?

Solution : The menstrual cycle is a series of cyclic physiological changes that take place inside the female reproductive tract in primates. The whole cycle takes around 28 days to complete. The end of the cycle is accompanied by the breakdown of uterine endothelium, which gets released in the form of blood and mucous through the vagina. This is known as menses. The follicle stimulating hormone (FSH), luteinizing hormone (LH), estrogen, and progesterone are the various hormones that regulate the menstrual cycle. The level of FSH and LH secreted from the anterior pituitary gland increases during the follicular phase. FSH secreted under the influence of RH (releasing hormone) from the hypothalamus stimulates the conversion of a primary follicle into a Graafian follicle. The level of LH increases gradually leading to the growth of follicle and secretion of estrogen. Estrogen inhibits the secretion of FSH and stimulates the secretion of luteinizing hormone. It also causes the thickening of the uterine endometrium. The increased level of LH causes the rupturing of the Graafian follicle and release the ovum into the fallopian tube. The ruptured Graafian follicle changes to corpus luteum and starts secreting progesterone hormone during the luteal phase. Progesterone hormone helps in the maintenance and preparation of endometrium for implantation of the embryo. High levels of progesterone hormone in the blood decrease the secretion of LH and FSH, therefore inhibiting further ovulation.

 

Question: What is parturition? Which hormones are involved in induction of parturition?

Solution : Parturition is the process of giving birth to a baby as the development of the foetus gets completed in the mother’s womb. The hormones involved in this process are oxytocin and relaxin. Oxytocin leads to the contraction of smooth muscles of myometrium of the uterus, which directs the full term foetus towards the birth canal. On the other hand, relaxin hormone causes relaxation of the pelvic ligaments and prepares the uterus for childbirth. 

 

Question: In our society women are often blamed for giving birth to daughters. Can you explain why this is not correct? 

Solution : All human beings have 23 pairs of chromosomes. Human males have 22 pairs of autosomes and contain one or two types of sex chromosome. They are either X or Y. On the contrary, human females have 22 pairs of autosomes and contain only the X sex chromosome. The sex of an individual is determined by the type of the male gamete (X or Y), which fuses with the X chromosome containing egg cell of the female. If the fertilizing sperm contains X, then the baby will be a girl and if it contains Y, then the baby will be a boy. Hence, it is incorrect to blame a woman for the gender of the child.

 

Question : How many eggs are released by a human ovary in a month? How many eggs do you think would have been released if the mother gave birth to identical twins? Would your answer change if the twins born were fraternal? 

Solution : An ovary releases an egg every month. When two babies are produced in succession, they are called twins. Generally, twins are produced from a single egg by the separation of early blastomeres resulting from the first zygotic cleavage. As a result, the young ones formed will have the same genetic make- up and are thus, called identical twins. If the twins born are fraternal, then they would have developed from two separate eggs. This happens when two eggs (one from each ovary) are released at the same time and get fertilized by two separate sperms. Hence, the young ones developed will have separate genes and are therefore, called non-identical or fraternal twins.

 

Question : How many eggs do you think were released by the ovary of a female dog which gave birth to 6 puppies?

Solution: Dogs and rodents are polyovulatory species. In these species, more than one ovum is released from the ovary at the time of ovulation. Hence, six eggs were released by the ovary of a female dog to produce six puppies.

 

Chapter 4 : Reproductive Health Biology

Question : What do you think is the significance of reproductive health in a society? 

Solution : Reproductive health refers to healthy reproductive organs with normal functions. It also includes physical, emotional, behavioural, and social aspects of reproduction. It helps in preventing various sexually transmitted diseases like syphilis, AIDS, etc.,. Educating people about available birth control options, care of pregnant mothers, postnatal care of the mother and child, the importance of breastfeeding, equal opportunities for the male and the female child, etc.would address the importance of bringing up socially conscious healthy families of desired size. It also helps in reducing social evils like sex-abuse and sex-related crimes, etc. This will help in building a socially responsible and healthy society.

 

Question: Suggest aspects of reproductive health which need to be given special attention in the present scenario. 

Solution : The aspects of reproductive health which need to be given special attention in the present scenario are: (i) Creating awareness among masses about hygienic sexual practices, sexually transmitted diseases (STD), available contraceptive methods, etc. (ii) Providing medical assistance and care to people in reproduction-related problems like pregnancy, delivery, STDs, abortions, contraception, menstrual problems, infertility, etc. 

 

Question: Is sex education necessary in schools? Why? 

Solution : Yes, sex education is necessary in schools to provide right information to the young adults so as to discourage children from believing in myths and having misconceptions about sex-related aspects. Proper information about reproductive organs, adolescence and related changes, safe and hygienic sexual practices, sexually transmitted diseases (STD), AIDS, etc., would help them to lead a healthy reproductive life. 

 

Question : Do you think that reproductive health in our country has improved in the past 50 years? If yes, mention some such areas of improvement. 

Solution : Yes, the reproductive health in our country has improved in the past 50 years. The areas of improvement are: (i) Better awareness about sex related matters. (ii) Increased number of medically assisted deliveries and better postnatal care leading to decreased maternal and infant mortality rates. (iii) Increased number of couples with small families. (iv) Better detection and cure of STDs and overall increased medical facilities for all sexrelated problems.

 

Question : What are the suggested reasons for population explosion? 

Solution: The suggested reason for population explosion are: (i) Rapid decline in death rate (ii) Decline in maternal mortality rate (iii) Decline in infant mortality rate (iv) Increase in number of people in reproducible age. (v) Increasing birth rate in the population 

 

Question: Is the use of contraceptives justified? Give reasons. 

Solution : Yes, the use of contraceptives is justified because (i) These help in controlling the rapid growth of human population. (ii) These do not interfere with the sexual desire or sexual act. (iii) These are also helpful in preventing unwanted pregnancies. (iv) Most contraceptives also help in preventing STDs 

 

Question: Removal of gonads cannot be considered as a contraceptive option. Why?

Solution: Removal of gonads cannot be considered as a contraceptive option because it will lead to permanent infertility. It will also stop the secretions of various important hormones necessary for the body.

 

Question : Amniocentesis for sex determination is banned in our country. Is this ban necessary? Comment. 

Solution : Yes, the ban is necessary because in our country it is being misused to detect the sex of the child before birth and then aborting if it is a female.

 

Question : Suggest some methods to assist infertile couples to have children.

Solution : Some methods to assist infertile couples to have children are:

(i) Test tube baby programme: The ova from the wife/donor (female) and sperm from the husband/donor (male) are collected and are induced to form zygote under simulated conditions in the laboratory. Then, zygote produced is then transferred into the fallopian tube of a normal female. (ii) Gamete Intra fallopian transfer (GIFT): Transfer of an ovum collected from a donor into the fallopian tube of another female who cannot produce ova, but can provide suitable environment for fertilisation. (iii) Intra cytoplasmic sperm injection (ICSI): A sperm is directly injected into the ovum. (iv) Artificial insemination (AI): The semen collected either from the husband or a healthy donor is artificially introduced either into the vagina or into the uterus of the female.

 

Question: What are the measures one has to take to prevent from contracting STDs? 

Solution: The measures one has to take to prevent from contracting STDs are: (i) Avoid sex with unknown partners/multiple partners. (ii) Always use condoms during coitus. (iii) In case of doubt, contact a qualified doctor for early detection and get complete treatment if diagnosed with disease.

 

Question : State True/False with explanation (a) Abortions could happen spontaneously too. (True/False) (b) Infertility is defined as the inability to produce a viable offspring and is always due to abnormalities/defects in the female partner. (True/False) (c) Complete lactation could help as a natural method of contraception. (True/False) (d) Creating awareness about sex related aspects is an effective method to improve reproductive health of the people. (True/False)

Solution : (a) True, due to some internal factors abortions could happen spontaneously too. (b) False, Infertility is defined as the inability of the couple to produce baby even after unprotected sexual cohabitation and it might occur due to abnormalities/defects in either male or female or both. (c) False, Complete lactation is a natural method of contraception but it is limited till lactation period, which continues till six months after parturition. (d) True, Creating awareness about sex related aspects provides necessary information about reproductive health. 

 

Chapter 6 : Molecular Basis of Inheritance

 

Question : Correct the following statements: (a) Surgical methods of contraception prevent gamete formation. (b) All sexually transmitted diseases are completely curable. (c) Oral pills are very popular contraceptives among the rural women.

Solution : Group the following as nitrogenous bases and nucleosides: Adenine, Cytidine, Thymine, Guanosine, Uracil and Cytosine. Solution 1: • Nitrogenous bases present in the list are adenine, thymine, uracil, and cytosine. • Nucleosides present in the list are cytidine and guanosine.

 

Question : If a double stranded DNA has 20 percent of cytosine, calculate the percent of adenine in the DNA. 

Solution : According to Chargaff's rule, the DNA molecule should have an equal ratio of pyrimidine (cytosine and thymine) and purine (adenine and guanine). It means that the number of adenine molecules is equal to thymine molecules and the number of guanine molecules is equal to cytosine molecules. % A = % T and % G = % C If ds DNA has 20% of cytosine, then according to the law, it would have 20% of guanine. Thus, the percentage of G + C content = 40% The remaining 60% represents both A + T molecules. Since adenine and thymine are always present in equal numbers, the percentage of adenine molecule is 30%. 

 

Question : If the sequence of one strand of DNA is written as follows: 5'-ATGCATGCATGCATGCATGCATGCATGC-3' Write down the sequence of complementary strand in 5' → 3' direction 

Solution : The DNA strands are complementary to each other with respect to base sequence. Hence, if the sequence of one strand of DNA is 5'- ATGCATGCATGCATGCATGCATGCATGC - 3' Then, the sequence of complementary strand in 3' to 5' direction will be 3'- TACGTACGTACGTACGTACGTACGTACG - 5' Therefore, the sequence of nucleotides on DNA polypeptide in 5' to 3' direction is 5'- GCATGCATGCATGCATGCATGCATGCAT - 3'.

 

Question : If the sequence of the coding strand in a transcription unit is written as follows: 5'-ATGCATGCATGCATGCATGCATGCATGC-3' Write down the sequence of mRNA. 

Solution : If the coding strand in a transcription unit is 5'- ATGCATGCATGCATGCATGCATGCATGC-3' This sequence that does not code for anything is the same as mRNA except that in mRNA thymine is replaced by uracil. Therefore the sequence of mRNA will be 5' - AUGCAUGCAUGCAUGCAUGCAUGCAUGC-3' 

 

Question : How did Hershey and Chase differentiate between DNA and protein in their experiment while proving that DNA is the genetic material? 

Solution : Hershey and Chase worked with bacteriophage and E.coli to prove that DNA is the genetic material. They used different radioactive isotopes to label DNA and protein coat of the bacteriophage. They grew some bacteriophages on a medium containing radioactive phosphorus (p32) to identify DNA and some on a medium containing radioactive sulphur (s35) to identify protein.(As DNA contains phosphorus and protein does not whereas protein contains Sulphur and DNA does not) Then, these radioactive labelled phages were allowed to infect E.coli bacteria. After infecting, the protein coat of the bacteriophage was separated from the bacterial cell by blending and then subjected to the process of centrifugation. Since the protein coat was lighter, it was found in the supernatant while the infected bacteria got settled at the bottom of the centrifuge tube. Hershey and Chase observed that when the bacteriophages contained radioactive phosphorus, the radioactivity was observed in the bottom of the test tube and that when the bacteriophage contained radioactive Sulphur radioactivity was observed in the supernatant. This proves that phosphorus containing DNA entered the bacterial cell whereas Sulphur containing protein coats were left outside the bacterial cell. Hence, it was proved that DNA is the genetic material as it was transferred from virus to bacteria.

 

Question : List two essential roles of ribosome during translation. 

Solution : The important functions of ribosome during translation are as follows. (a) Ribosome acts as the site where protein synthesis takes place from individual amino acids. It is made up of two subunits. The smaller subunit comes in contact with mRNA and forms a protein synthesizing complex whereas the larger subunit acts as an amino acid binding site. 

 

Question: 

List two essential roles of ribosome during translation. 

Solution : The important functions of ribosome during translation are as follows. (a) Ribosome acts as the site where protein synthesis takes place from individual amino acids. It is made up of two subunits. The smaller subunit comes in contact with mRNA and forms a protein synthesizing complex whereas the larger subunit acts as an amino acid binding site.

 

Question : Explain (in one or two lines) the function of the followings: (a) Promoter (b) tRNA (c) Exons 

 Solution: (a) Promoter Promoter is a region of DNA that helps in initiating the process of transcription. It serves as the binding site for RNA polymerase. (b) tRNA tRNA or transfer RNA is a small cloverleaf shaped RNA that reads the genetic code present on mRNA. It carries a specific amino acid to mRNA on ribosome during translation of proteins. There are specific tRNAs for specific amino acids (c) Exons Exons are coding sequences of DNA in eukaryotes that transcribe for proteins. They contain long non-coding regions of DNA called introns in between.

 

Question : What is DNA fingerprinting? Mention its application

 Solution: DNA fingerprinting is a technique used to identify and analyze the variations in various individuals at the level of DNA.

It is based on variability and polymorphism in DNA sequences.

 

Application

(1) It is used in forensic science to identify potential crime suspects.

(2) It is used to establish paternity and family relationships.

(3) It is used to identify and protect the commercial varieties of crops and livestock.

(4) It is used to find out the evolutionary history of an organism and trace out the linkages between groups of various organisms.

 

Question : Depending upon the chemical nature of the template (DNA or RNA) and the nature of nucleic acids synthesized from it (DNA or RNA), list the types of nucleic acid polymerases.

Solution : There are two different types of nucleic acid polymerases.

(1) DNA-dependent DNA polymerases

(2) DNA-dependent RNA polymerases

 

Question : How did Hershey and Chase differentiate between DNA and protein in their experiment while proving that DNA is the genetic material? 

Solution : Hershey and Chase worked with bacteriophage and E.coli to prove that DNA is the genetic material. They used different radioactive isotopes to label DNA and protein coat of the bacteriophage. They grew some bacteriophages on a medium containing radioactive phosphorus (p32) to identify DNA and some on a medium containing radioactive sulphur (s35) to identify protein.(As DNA contains phosphorus and protein does not whereas protein contains Sulphur and DNA does not) Then, these radioactive labelled phages were allowed to infect E.coli bacteria. After infecting, the protein coat of the bacteriophage was separated from the bacterial cell by blending and then subjected to the process of centrifugation. Since the protein coat was lighter, it was found in the supernatant while the infected bacteria got settled at the bottom of the centrifuge tube. Hershey and Chase observed that when the bacteriophages contained radioactive phosphorus, the radioactivity was observed in the bottom of the test tube and that when the bacteriophage contained radioactive Sulphur radioactivity was observed in the supernatant. This proves that phosphorus containing DNA entered the bacterial cell whereas Sulphur containing protein coats were left outside the bacterial cell. Hence, it was proved that DNA is the genetic material as it was transferred from virus to bacteria. 

 

Question : List two essential roles of ribosome during translation. 

Solution : The important functions of ribosome during translation are as follows. (a) Ribosome acts as the site where protein synthesis takes place from individual amino acids. It is made up of two subunits. The smaller subunit comes in contact with mRNA and forms a protein synthesizing complex whereas the larger subunit acts as an amino acid binding site.

(b) The large subunit of ribosome has two sites for attaching tRNA. This allows the amino acids to come close to each other for the formation of peptide bond. Ribosome also acts as a catalyst for forming peptide bond. For example, 23s r-RNA in bacteria acts as a ribozyme.

 

Question : Explain (in one or two lines) the function of the followings: (a) Promoter (b) tRNA (c) Exons 

Solution: (a) Promoter Promoter is a region of DNA that helps in initiating the process of transcription. It serves as the binding site for RNA polymerase. (b) tRNA tRNA or transfer RNA is a small cloverleaf shaped RNA that reads the genetic code present on mRNA. It carries a specific amino acid to mRNA on ribosome during translation of proteins. There are specific tRNAs for specific amino acids (c) Exons Exons are coding sequences of DNA in eukaryotes that transcribe for proteins. They contain long non-coding regions of DNA called introns in between.

 

Question : Why is the Human Genome project called a mega project? 

Solution : Human Genome project was considered to be a mega project because of the scale and the goals of the project. It had a specific goal to sequence every base pair present in the human genome. The human genome contains approximately 3 x 109 base pairs and this had an estimated cost of 9 billion US dollars. It took around 13 years for its completion and got accomplished in year 2006. It was a large scale project, which aimed at developing new technology for data storage, retrieval and analysis. It also aimed at generating new information in the field of genomic studies. As a result of it, several new areas and avenues have opened up in the field of genetics, biotechnology, and medical sciences. The new and related technology developed were also transferred to other sectors. It provided clues regarding the understanding of human biology.

 

Question : Briefly describe the following: (a) Transcription (b) Polymorphism (c) Translation (d) Bioinformatics 

Solution : (a) Transcription Transcription is the process of synthesis of mRNA from DNA template. A segment of DNA gets copied into mRNA during the process. The process of transcription starts at the promoter region of the template DNA and terminates at the terminator region. The segment of DNA between these two regions is known as transcription unit. The transcription requires RNA polymerase enzyme, a DNA template, four types of ribonucleotides, and certain cofactors such as Mg2+ . The three important events that occur during the process of transcription are as follows. (i) Initiation (ii) Elongation (iii) Termination The DNA-dependent RNA polymerase and certain initiation factors () bind at the double stranded DNA at the promoter region of the template strand and initiate the process of transcription. RNA polymerase moves along the DNA and leads to the unwinding of DNA duplex into two separate strands. Then, one of the strands, called sense strand acts as a template for mRNA synthesis. The enzyme, RNA polymerase, utilizes nucleoside triphosphates (dNTPs) as raw material and polymerizes them to form mRNA according to the complementary bases present on the template DNA. This process of opening of helix and elongation of polynucleotide chain continues until the enzyme reaches the terminator region. As RNA polymerase reaches the terminator region, the newly synthesized mRNA transcript along with enzyme is released. Another factor called terminator factor () is required for the termination of the transcription.

 

Chapter 7 : Evolution

Question : Explain antibiotic resistance observed in bacteria in light of Darwinian selection theory. 

Solution : According to Darwin, environment selects organisms with favorable variations and these organisms are able to survive. When a bacterial population encounters a particular antibiotic, those sensitive to it die. But some bacteria that have favorable mutations become resistant to the antibiotic. Such resistant bacteria survive and multiply quickly as the competing bacteria have died. Thus, their numbers increase. Additionally they may also pass on the genes imparting resistance to other members of the population. Therefore, antibiotic resistance become widespread and entire bacterial population becomes resistant. 

 

Question : Find out from newspapers and popular science articles any few fossil discoveries or controversies about evolution. 

Solution : Chimps are more evolved than humans (The Times of India): A study suggests that chimpanzees are more evolved than humans. There is no doubt that humans are the more advanced species. But a comparison of 14,000 human and chimpanzee genes shows the forces of natural selection have had the greatest impact on our ape cousins. The researcher’s discovery challenges the common assumption that our large brains and high intelligence were the gifts of natural selection. Humans and chimps followed different evolutionary paths from a common ape ancestor about 5 million years ago. Both underwent changes as the fittest survived to pass their genes on to future generations. But the US study shows that humans possess a ‘substantially smaller’ number of positively-selected genes than chimps. 

 

Question : Attempt giving a clear definition of the term species. 

Solution : Species is population or group of individuals that have potential of interbreeding and are able to produce viable and fertile young ones.

 

Question : Find out through the internet and popular science articles whether animals other than man has self consciousness. 

Solution : Self-awareness is the capacity for introspection and the ability to recognize oneself as an individual separate from the environment and other individuals. It is a measure of intelligence in the animal kingdom and yet most living species do not possess it. Of the many animals tested few animals other than humans have shown this capacity. They are orangutans, chimpanzees, gorillas, bottlenose dolphins, elephants, orcas, bonobos, Rhesus macaques and European Magpies.. Among domestic animals, dog and other members of the Canidae family show subtle self consciousness. 

 

Question : Practice drawing various animals and plants. 

Solution : Select few plants and animals that you find relatively easy to draw and label and practice to make these diagrams perfect. You can take suggestions from teachers, parents or even look up on the internet for simple animal and plant figures.

 

Question : Describe one example of adaptive radiation. 

Solution : Adaptive radiation is when members of a single group or lineage evolutionarily diverge into a variety of different forms. These forms are dictated by natural selection and the use of habitats or resources. Darwin’s finches of the Galapagos islands had common ancestors but now have different types of modified beaks according to their food habits. These finches have developed different eating habits and different types of beaks to suit their feeding habits. The insectivorous, blood sucking, and other species of finches with varied dietary habits have evolved from a single seed eating finch ancestor.

 

Question : Can we call human evolution as adaptive radiation? 

Solution : No, human evolution cannot be called adaptive radiation. Adaptive radiation can be defined as an evolutionary process that produces new species from a single common ancestor. In case of human evolution, while we share a common ancestor we have undergone gradual but progressive modification in our body structure, eating habits, etc. Human evolution does not involve diversifying and radiating into different species which is characteristic of adaptive radiation. 

 

Question : Using various resources such as your school library or the internet and discussions with your teacher, trace the evolutionary stages of any one animal say horse. 

Solution : The evolution of horse started with Eohippus during the Eocene period. It involved the following evolutionary stages. Eohippus – Mesohippus – Merychippus – Pliohippus – Equus. Evolutionary trend: (i) Increase in body size. (ii) Elongation of neck. (iii) Lengthening of limbs. (iv) Enlargement of third digit. (v) Gradual reduction of lateral digits (vi) Increase in structural complexity of teeth for feeding on grass (vii) Strengthening of back (viii) Development of brain and sensory organs.

 

Question : Practice drawing various animals and plants. 

Solution : Select few plants and animals that you find relatively easy to draw and label and practice to make these diagrams perfect. You can take suggestions from teachers, parents or even look up on the internet for simple animal and plant figures.

 

Question : Describe one example of adaptive radiation. 

Solution : Adaptive radiation is when members of a single group or lineage evolutionarily diverge into a variety of different forms. These forms are dictated by natural selection and the use of habitats or resources.Darwin’s finches of the Galapagos islands had common ancestors but now have different types of modified beaks according to their food habits. These finches have developed different eating habits and different types of beaks to suit their feeding habits. The insectivorous, blood sucking, and other species of finches with varied dietary habits have evolved from a single seed eating finch ancestor.

 

Question : Can we call human evolution as adaptive radiation? 

Solution : No, human evolution cannot be called adaptive radiation. Adaptive radiation can be defined as an evolutionary process that produces new species from a single common ancestor. In case of human evolution, while we share a common ancestor we have undergone gradual but progressive modification in our body structure, eating habits, etc. Human evolution does not involve diversifying and radiating into different species which is characteristic of adaptive radiation. 

 

Question: Using various resources such as your school library or the internet and discussions with your teacher, trace the evolutionary stages of any one animal say horse. 

Solution : The evolution of horse started with Eohippus during the Eocene period. It involved the following evolutionary stages. Eohippus – Mesohippus – Merychippus – Pliohippus – Equus. Evolutionary trend: (i) Increase in body size. (ii) Elongation of neck. (iii) Lengthening of limbs. (iv) Enlargement of third digit. (v) Gradual reduction of lateral digits (vi) Increase in structural complexity of teeth for feeding on grass (vii) Strengthening of back (viii) Development of brain and sensory organs 

 

Chapter 8 – Human Health and Disease

Question: What are the various public health measures, which you would suggest as safeguard against infectious diseases? 

Solution : Public health measures are preventive measures which are taken to check the spread of various infectious diseases. These measures should be taken to reduce the contact with infectious agents. Some of these methods are: (1) Maintenance of personal and public hygiene: It is one of the most important methods of preventing infectious diseases. This measure includes maintaining a clean body, consumption of healthy and nutritious food, drinking clean water, etc. Public hygiene includes proper disposal of waste material, excreta, periodic cleaning, and disinfection of water reservoirs. (2) Isolation of infected person: To prevent the spread of air-borne diseases such as pneumonia, chicken pox, tuberculosis, etc., it is essential to keep the infected person in isolation to reduce the chances of spreading these diseases. (3) Vaccination: Vaccination is the protection of the body from communicable diseases by administering some agent that mimics the microbe inside the body. It helps in providing active and passive immunization to the body. Several vaccines are available against many diseases such as tetanus, polio, measles, mumps, etc. (4) Vector Eradication: Various diseases such a malaria, filariasis, dengue, and chikungunya spread through vectors. Thus, these diseases can be prevented by providing a clean environment and by preventing the breeding of mosquitoes. This can be achieved by not allowing water to stagnate around residential areas. Also, measures like regular cleaning of coolers, use of mosquito nets and insecticides such as malathion in drains, ponds, etc. can be undertaken to ensure a healthy environment. Introducing fish such as Gambusia in ponds also controls the breeding of mosquito larvae in stagnant water. 

 

Question : In which way has the study of biology helped us to control infectious diseases? 

Solution : Various advancements that have occurred in the field of biology have helped us to gain a better understanding to fight against various infectious diseases. Biology has helped us study the life cycle of various parasites, pathogens, and vectors along with the modes of transmission of various diseases and the measures for controlling them. Vaccination programmes against several infectious diseases such as smallpox, chicken pox, tuberculosis, etc. have helped nearly eradicate these diseases. Biotechnology has helped in the preparation of newer of safer drugs and vaccines. Antibiotics have also played an important role in treating infectious diseases. 

 

Question : Discuss with your teacher what does ‘a suitable gene’ means, in the context of DNA vaccines. 

Solution : A ‘suitable gene’ refers to a specific DNA segment which can be injected into the cells of the host body to produce specific proteins. This protein kills the specific disease-causing organism in the host body and provides immunity

 

Question : Name the primary and secondary lymphoid organs. 

Solution : (a) Primary lymphoid organs include the bone marrow and the thymus. (b) Secondary lymphoid organs are the spleen, lymph nodes, tonsils, Peyer’s patches of the small intestine, and appendix. 

 

Question : The following are some well-known abbreviations, which have been used in this chapter. Expand each one to its full form: (a) MALT (b) CMI (c) AIDS (d) NACO (e) HIV 

Solution : (a) MALT – Mucosa – Associated Lymphoid Tissue (b) CMI – Cell – Mediated Immunity (c) AIDS – Acquired ImmunoDeficiency Syndrome (d) NACO – National AIDS control organization (e) HIV – Human Immunodeficiency Virus.

 

Question : What are the various routes by which transmission of human immunodeficiency virus takes place? 

Solution : AIDS (Acquired ImmunoDeficiency Syndrome is caused by the Human Immunodeficiency virus HIV). It has the following modes of transmission: (a) Unprotected sexual contact with an infected person. (b) Transfusion of blood from an infected to a healthy person. (c) Sharing infected needles and syringes. (d) From an infected mother to a child through the placenta.

 

Question : Do you think that friends can influence one to take alcohol/drugs? If yes, how may one protect himself/herself from such an influence? 

Solution : Yes, friends can influence one to take drugs and alcohol. A person can take the following steps to protect himself/herself against drug abuse: (a) Increase your willpower to stay away from alcohol and drugs. One should not experiment with alcohol for curiosity and fun. (b) Avoid the company of friends who take drugs. (c) Seek help from parents and peers. (d) Take proper knowledge and counseling about drug abuse. Devote your energy in other extracurricular activities. (e) Seek immediate professional and medical help from psychologists and psychiatrists if symptoms of depression and frustration become apparent. 

 

Question : Why is that once a person starts taking alcohol or drugs, it is difficult to get rid of this habit? Discuss it with your teacher. 

Solution : Drug and alcohol consumption has an inherent addictive nature associated with euphoria and a temporary feeling of well-being. Repeated intake of drugs increases the tolerance level of the body’s receptors, leading to more consumption of drugs.

 

Question : In your view what motivates youngsters to take to alcohol or drugs and how can this be avoided? 

Solution : Many factors are responsible for motivating youngsters towards alcohol or drugs. Curiosity, need for adventure and excitement, experimentation are the initial causes of motivation. Some youngsters start consuming drugs and alcohol in order to overcome negative emotions (such as stress, pressure, depression, frustration) and to excel in various fields. Several mediums like television, internet, newspaper, movies etc. are also responsible for promoting the idea of alcohol to the younger generation. Amongst these factors, reasons such as unstable and unsupportive family structures and peer pressure can also lead an individual to be dependent on drugs and alcohol. Preventive measures against addiction of alcohol and drugs: (a) Parents should motivate and try to increase the will power of their child. (b) Parents should educate their children about the ill-effects of alcohol. They should provide them with proper knowledge and counseling regarding the consequences of addiction to alcohol. (c) It is the responsibility of the parent to discourage a child from experimenting with alcohol. Youngsters should be kept away from the company of friends who consume drugs. (d) Children should be encouraged to devote their energy in other extra-curricular and recreational activities. (e) Proper professional and medical help should be provided to child if sudden symptoms of depression and frustration are observed.

 

Chapter 9: Strategies for Enhancement in Food Production

Question : Explain in brief the role of animal husbandry in human welfare.

Solution : (i) Animal husbandry deals with the scientific management of livestock which includes various aspects such as feeding, breeding, and control diseases to raise the population of animal livestock. (ii) It usually deals with animals such as buffaloes cattle, pigs, sheep, poultry, and fish which are useful for humans in various ways. (iii)These animals are used for the production of commercially important products such as milk, meat, wool, eggs, honey, silk, etc. (iv)As an increase in human population, there is a demand for the products from livestock. So it is necessary to improve the management of livestock.

 

Question : If your family owned a dairy farm, what measures would you undertake to improve the quality and quantity of milk production? 

Solution : (i) Dairy farm management deals with processes which aim at improving the quality and quantity of milk production. Milk production is primarily dependent on choosing improved cattle breeds, provision of proper feed for cattle, maintaining proper shelter facilities, and regular cleaning of cattle. (ii) Improved cattle breed is an important factor of cattle management. Hybrid cattle breeds are introduced for improved productivity. Thus, it is important that hybrid cattle breeds should have a combination of various desirable genes such as high milk production and high resistance to diseases. (iii) Cattle should also be given high quality and nutritious food including roughage, fibre concentrates, and high levels of proteins and other nutrients. (iv)Cattle should be kept in well maintained house in proper cattle-houses and should be kept in well ventilated roofs to prevent them from bad climatic conditions such as heat, cold, and rain. (v) Regular baths and proper brushing should be ensured to control diseases. Also, regular checkups by a veterinary doctor for symptoms of various diseases. 

 

Question : What is meant by the term 'breed'? What are the objectives of animal breeding? 

Solution : A breed is an improved variety of animals within a species. It is similar in most characters such as general appearance, size, configuration, and features with other members of the same species. For example- Jersey and Brown Swiss are foreign breeds of cattle. These two varieties of cattle have the ability to produce abundant quantities of milk which is nutritious with high protein content. Objectives of animal breeding: (i) To improve the desirable qualities of the animal produce (ii) To increase the yield of animals (iii)To produce disease-resistant varieties of animals.

 

Question : Discuss the role of fishery in enhancement of food production. 

Solution : (i) Fishery is an industry devoted with catching, processing, and marketing of fish and other aquatic animals that have a high economic value. (ii) Some commercially important aquatic animals are prawns, crabs, oysters, lobsters, and octopus. (iii)Fisheries play an important role in the Indian economy. This is because a large part of the Indian population is dependent on fish as a source of food, which is both cheap and high in animal protein. (iv) Fishery is an employment generating industry especially for people staying in the coastal areas. Both freshwater fishes (such as Catla, Rohu, etc) and marine fish (such as tuna, mackerel, pomfret, etc.) are of high economic value.
 

Question : Briefly describe various steps involved in plant breeding. 

Solution : Plant breeding is the purposeful manipulation of plant species in order to create desired plants that are better suited for cultivation, give better yield and are disease resistant.Various steps involved in plant breeding are as follows: (i) Collection of genetic variability: Genetic variability from various wild relatives of the cultivated species are collected to maintain the genetic diversity of a species. The entire collection of the diverse alleles of a gene in a crop is called the germplasm collection. (ii) Evaluation of germplasm and selection of parents: The germplasm collected is then evaluated for the desirable genes. The selected plants with the desired genes are then used as parents in plant breeding experiments and are multiplied by the process of hybridization. (iii)Cross-hybridization between selected parents: The next step in plant breeding is to combine the desirable characters present in two different parents to produce hybrids. It is a tedious job as one has to ensure that the pollen grains collected from the male parent reach the stigma of the female parent. (iv)Selection of superior hybrids: the selection process is crucial to the success of breeding objective and requires careful scientific evaluation of the progeny. The progenies of the hybrids having the desired characteristics are selected through scientific evaluation. The selected progenies are then self-pollinated for several generations to ensure homozygosity. (v) Testing, release, and commercialization of new cultivars: the newly selected lines are evaluated for their yield and other agronomic traits of quality, disease resistance, by growing them in research fields for at least three growing seasons in different parts of the country. After thorough testing and evaluation, the selected varieties are given to the farmers for growing in fields for a large-scale production. 

 

Question : Explain what is meant by biofortification.

Solution : Biofortification is a process of breeding crops with higher levels of vitamins, minerals, proteins, and fat content. This method is employed to improve public health. Breeding of crops with improved nutritional quality is undertaken to improve the content of proteins, oil, vitamins, minerals, and micronutrients in crops. It is also undertaken to upgrade the quality of oil and proteins. An example of this is a wheat variety known as Atlas 66, which has high protein content in comparison to the existing wheat. In addition, there are several other improved varieties of crop plants such as rice.

 

Question : Which part of the plant is best suited for making virus-free plants and why? 

Solution : Apical and axillary meristems of plant is used for making virus-free plants. In a diseased plant, only this region is not infected by the virus as compared to the rest of the plant’s other regions. Hence, the scientists remove axillary and apical meristems of the diseased plant and grow it in vitro to obtain a disease-free and healthy plant. Banana, sugarcane, and potato have been obtained using this method by scientists are virus free plants.

 

Question : What is the major advantage of producing plants by micropropagation?

Solution : Micropropagation is a method of producing new plants in a short duration using plant tissue culture. Some major advantages of micropropagation are as follows: (i) Micropropagation helps in the propagation of a large number of plants in a short span of time. (ii) The plants produced are identical to the mother plant. (iii)It leads to the production of healthier plantlets, which exhibit better disease-resisting powers.

 

Question : Find out what the various components of the medium used for propagation of an explant in vitro are? 

Solution : The major components of medium used for propagation of explants in vitro are carbon sources such as sucrose, inorganic salts, vitamins, amino acids, water, agar-agar, and certain growth hormones such as auxins and gibberellins.

 

Chapter 10 : Microbes in Human Welfare

Question: Bacteria cannot be seen with the naked eye, but these can be seen with the help of a microscope. If you have to carry a sample from your home to your biology laboratory to demonstrate the presence of microbes under a microscope, which sample would you carry and why? 

Solution : Curd can be used as a sample for the study of microbes. Curd contains numerous lactic acid bacteria (LAB) or Lactobacillus. These bacteria produce acids that coagulate and digest milk proteins. A small drop of curd is carried to the biology laboratory because it contains a multitude of bacteria, which can be easily observed under a microscope which are of various shapes and sizes.

 

Question: Give examples to prove that microbes release gases during metabolism. 

Solution : The examples of bacteria that release gases during metabolism are: (a) The dough used for making idli and dosa gives a puffed appearance. This is because of the action of bacteria which releases carbon dioxide. This CO2 released from the dough gets trapped in the dough, thereby giving it a puffed appearance. (b) During the digestion of sludge during wastewater treatment, bacteria produce a mixture of gases such as methane, hydrogen sulphide and carbon dioxide.

 

Question: In which food would you find lactic acid bacteria? Mention some of their useful applications. 

Solution : Lactic acid bacteria can be found in curd. Some of their useful applications are as follows: (i) It is this bacterium that promotes the formation of milk into curd. (ii) The bacterium multiplies and increases its number, which converts the milk into curd. (iii)They also increase the content of vitamin B12 in curd. (iv)Lactic acid bacteria are also found in our stomach where it keeps a check on the disease causing microorganisms.

 

Question: Name some traditional Indian foods made of wheat, rice and Bengal gram (or their products) which involve the use of microbes. 

Solution : (i) In the making dosa and idli, rice powder is fermented by bacteria and for making bread (from wheat), yeast (Saccharomyces cerevisiae) is used. (ii) Gutta (made from black gram) also uses bacteria. (iii)Microbes are also used to ferment fish, soya bean and bamboo shoots to make food. 

 

Question : In which way have microbes played a major role in controlling diseases caused by harmful bacteria? 

Solution : (i) Several microorganisms are used for preparing medicines. Antibiotics are medicines produced by certain microorganisms to kill other disease-causing microorganisms. (ii) These medicines are commonly obtained from bacteria and fungi. They either kill or stop the growth of disease-causing microorganisms. (iii)Antibiotics have been used to treat deadly diseases such as plague, whooping cough (kali khansi), diphtheria (galghotu) and leprosy (kusht rog) and many other common infections can be treated by using different antibiotics as Streptomycin, tetracycline, and penicillin are common ones . (iv) Penicillium notatum, is a fungus, produces chemical penicillin, which checks the growth of Staphylococci bacteria in the body. (v) Antibiotics are designed to destroy bacteria by weakening their cell walls. As a result of this weakening, certain immune cells such as the white blood cells enter the bacterial cell and cause cell lysis. Cell lysis is the process of destroying cells such as blood cells and bacteria. 

 

Question : What is sewage? In which way can sewage be harmful to us? 

Solution : Sewage is the municipal waste matter that is carried away in sewers and drains. It includes both liquid and solid wastes, rich in organic matter and microbes. Many of these microbes are pathogenic and can cause several water- borne diseases. Sewage water is a major cause of polluting drinking water. Hence, it is essential that sewage water is properly collected, treated, and then disposed.

 

Question : What is the key difference between primary and secondary sewage treatment? 

Solution : Primary treatment involves physical/mechanical removal of large and small particles from the sewage through filtration and sedimentation. Whereas, secondary sewage treatment involves biological digestion of organic matter by microbes. Primary treatment is inexpensive and relatively less complicated whereas secondary sewage is a very expensive and complicated process.

 

Question : Do you think microbes can also be used as a source of energy? If yes, how? 

Solution : Yes, microbes can be used as a source of energy. Bacteria such as Methane bacterium is used for the generation of gobar gas or biogas. 

(i) The generation of biogas is an anaerobic process in a biogas plant, which consists of a concrete tank (10-15 feet deep) with sufficient outlets and inlets. 

(ii) The dung is mixed with water to form the slurry and thrown into the tank. The digester of the tank is filled with numerous anaerobic methane-producing bacteria, which produce biogas from the slurry. 

(iii) Biogas can be removed through the pipe which is then used as a source of energy, while the spent slurry is removed from the outlet and is used as a fertilizer. 
 

 

Question : Microbes can be used to decrease the use of chemical fertilizers and pesticides. Explain how this can be accomplished. 

Solution : Microbes can be used as biofertilizers, organisms that enrich the nutrient quality of the soil. The main sources of biofertilizers are bacteria, fungi and cyanobacteria.They help in increasing the fertility of the soil in many ways (i) Rhizobium that forms nodules on the roots of leguminous plants (a symbiotic association) fixes atmospheric nitrogen into organic form, which is used by the plant as nutrient. (ii) Azospirillum and Azotobacter fix atmospheric nitrogen, while living freely, and enriching the nitrogen content of the soil. (iii)Many members of the genus Glomus (fungi) form symbiotic association with vascular host plants known as mycorrhiza that (a) Helps in the absorption of phosphorus from soil and pass it to the plant. (b) Help the plants to develop resistance to root-borne pathogens. (c) Increase their tolerance to salinity and drought and thus, help in overall increase in plant growth and development. (iv)Cyanobacteria autotrophic microbes, e.g., Anabaena, Nostoc, Oscillatoria can fix atmospheric nitrogen, in aquatic and terrestrial environment and also add organic matter to the soil and increase its fertility.

 

Question: Three water samples namely river water, untreated sewage water and secondary effluent discharged from a sewage treatment plant were subjected to BOD test. The samples were labelled A, B and C; but the laboratory attendant did not note which was which. The BOD values of the three samples A, B and C were recorded as 20mg/L, 8mg/L and 400mg/L, respectively. Which sample of the water is most polluted? Can you assign the correct label to each assuming the river water is relatively clean?

 Solution : Sample A (BOD 20mg/L) is secondary effluent discharged from a sewage treatment plant. Sample B (BOD 8mg/L) is river water. Sample C (BOD 400mg/L) is the untreated sewage water.As BOD is the direct measure of the organic matter present in water, the higher the BOD, the more polluted the water.

 

Question : Find out the name of the microbes from which Cyclosporin A (an immunosuppressive drug) and Statins (blood cholesterol lowering agents) are obtained 

Solution : (i) Cyclosporin-A is obtained from the fungus Trichoderma polysporum. (ii) Statins is obtained from Monascus purpureus.

 

Question : Find out the role of microbes in the following and discuss it with your teacher. (a) Single cell protein (SCP) (b) Soil 

Solution : (a) Single Cell Protein (SCP) refers to harmless microbial cells that can be used as an alternate source of good protein. Just like mushrooms (a fungus) is eaten by many people and yeast used by athletes as a protein source; similarly, other forms of microbial cells can also be used as food rich in protein, minerals, fats, carbohydrate and vitamins. Microbes like Spirulina and Methylophilus methylotrophus are being grown on an industrial scale on materials containing starch like waste water from potato processing plants, straw, molasses, animal manure and even sewage. These single cell microbes can be used as source. (b) Soil: Microbes play an important role in maintaining soil fertility. They help in the formation of nutrient-rich humus by the process of decomposition. Many species of bacteria and cyanobacteria have the ability to fix atmospheric nitrogen into usable form. Rhizobium is a symbiotic bacteria found in the root nodules of leguminous plants. Azospirillum and Azotobacter are free living nitrogen-fixing bacteria, whereas Anabaena, Nostoc, and Oscillitoria are examples of nitrogen-fixing cyanobacteria.

 

Question : How do biofertilizers enrich the fertility of the soil? 

Solution : Bio-fertilizers are living organisms which help in increasing the fertility of soil. It involves the selection of beneficial microorganisms that help in improving plant growth through the supply of plant nutrients. These are introduced to seeds, roots, or soil mobilize the availability of nutrients by their biological activity. Thus, they are extremely beneficial in enriching the soil with organic nutrients. Many species of bacteria and cyanobacteria have the ability to fix free atmospheric nitrogen. Rhizobium is a symbiotic bacteria found in the root nodules of leguminous plants. Azospirillum and Azotobacter are free living nitrogen-fixing bacteria, whereas Anabaena, Nostoc, and Oscillitoria are examples of nitrogen-fixing cyanobacteria. Bio-fertilizers are cost effective and eco-friendly.

 

Chapter 11: Biotechnology-Principles and Processes 

Question : Can you list 10 recombinant proteins which are used in medical practice? Find out where they

are used as therapeutics (use the internet).

Solution : (i) Human insulin – Diabetes

(ii) Human growth hormone – Dwarfism cure

(iii)Blood clotting factor Y1H/IX-Hemophilia

(iv)TPA (tissue plasminogen activator) – Heart attack/strokes

(v) PDGF (platelet derived growth factor) – Stimulates wound healing.

(vi)Interferon – Treatment of viral infection.

(vii) Interleukin – Enhances immune reaction,

(viii) Hepatitis B vaccine – Prevention of infection infection caused due to Hepatitis B Virus.

(ix)Herpes Vaccine – Prevention of infectious disease.

(x) DNase I – Treatment of cystic fibrosis. 

 

Question : Make a chart (with diagrammatic representation) showing a restriction enzyme, the substrate DNA on which it acts, the site at which it cuts DNA and the product it produces. 

Solution : Name of the Restriction endonuclease enzyme is – Bam H1. It attaches to the site at the 5'- GGATCC-3’. This cleaves DNA in these sequences at just after 5’-G on both strands.

 

Question : From what you have learnt, can you tell whether enzymes are bigger or DNA is bigger in molecular size? How did you know? 

Solution : Enzymes are smaller than DNA as they are proteins and proteins are macromolecules made up of amino acids which are smaller than nucleotides. Enzymes are proteins and their synthesis is regulated by small portions of DNA, called genes. Three nucleotides in a specific sequence called as codon in mRNA, helping in the coding of one amino acid, which polymerize to form a specific polypeptide chain and later after certain modifications makes protein. 

 

Question : What would be the molar concentration of human DNA in a human cell? Consult your teacher. 

Solution : The molar concentration of DNA in human cells is 2 mg/ml of cell extract. 

 

Question : Do eukaryotic cells have restriction endonucleases? Justify your answer. 

Solution : No, eukaryotic cells do not have restriction endonuclease because DNA molecules of eukaryotes are heavily methylated by an enzyme methylase. Methylation protects the DNA from the activity of restriction enzymes. All the restriction endonucleases have been isolated from various strains of bacteria or prokaryotic cells.

 

Question : Besides better aeration and mixing properties, what other advantages do stirred tank bioreactors have over shake flasks? 

Solution : Shake flasks are used for growing and mixing the desired materials on a small scale in the laboratory. A large scale production of desired biotechnological product is done by using ‘bioreactors’. Besides better aeration and mixing properties, the bioreactors have following advantages (i) Small volumes of cultures are periodically withdrawn from bioreactor for sampling. (ii) It has a foam control system as foam breaker for regulating the foam formed during the process, pH control system and temperature control system. (iii) Facilitates even mixing and oxygen availability with the help of baffles, throughout the bioreactor. 

 

Question : Can you recall meiosis and indicated at what stage a recombinant DNA is made? 

Solution : Meiosis I – During Prophase 1 in Pachytene – When recombination nodule appears after synaptonemal complex formation.

 

Question : Can you think and answer how a reporter enzyme can be used to monitor transformation of host cells by foreign DNA in addition to a selectable marker? 

Solution : A reporter enzyme can be used to differentiate transformed cells by tracking down the activity of its corresponding genes (receptor gene). For e.g., (3-galactosidase (Lac Z) activity is not found in transformed cells so that they appear white in colour. The others, which appear blue in colour, indicate that cells do not carry foreign DNA.

 

Question : (a) PCR (b) Restriction enzymes and DNA (c) Chitinase 

Solution : (a) PCR - Polymerase chain reaction (in vitro method) is a molecular biological technique for enzymatically amplification of a single small strand or few copies of a segment of DNA in several orders of magnitude and millions of copies of a specific DNA sequence in a short time period (approx 2 hrs). 3 steps in PCR are : (i) Denaturation (at 96 ºC) of desired double strand DNA- to ssDNA. (ii) Annealing of primer (at 55-65 ºC) to ssDNA (single standard). (iii) Extension (at 72 ºC)of primer by Taq DNA polymerase isolated from Thermus aquaticus, synthesizing new DNA strands. 

Uses – Amplification of desired gene / gene cloning. Advantage – More output, greater efficiency, less error prone, less human interference and cyclic and automated. (b) Restriction enzymes and DNA – Restriction enzymes is a group of enzymes used to cleave or cut DNA strands, each having a characteristic base sequence at which it cleaves known as recognition site or restriction site. (i) It restricts foreign DNA from entering normal cells by digesting it at various recognition sites. Recognition site is palindromic. (ii) They are endonuclease and exonuclease both types. (iii)They produce sticky ends. Cleavage site and recognition site are different from each other. Restriction enzymes therefore are believed to be a mechanism evolved by bacteria to resist viral attack and to help in the removal of viral sequences. (c) Chitinase – Chitinase is a hydrolytic enzymes that digest or break down glycosidic bonds in chitin present in the cell wall of fungal cell and exoskeleton of some animals including worms and arthropods, to facilitate its transformation or digestion. 

 

Chapter 12 : Biotechnology and Its Applications

Question : Crystals of Bt toxin produced by some bacteria do not kill the bacteria themselves because- (a) bacteria are resistant to the toxin (b) toxin is immature; (c) toxin is inactive; (d) bacteria encloses toxin in a special sac. 

Solution : (c) Toxin is inactive. In bacteria, the toxin is present in an inactive form called Prototoxin, which gets converted into active form when it enters the body of an insect. 

 

Question : What are transgenic bacteria? Illustrate using any one example. 

Solution : Bacteria carrying foreign gene which is introduced into the bacterial plasmid/genome are called transgenic bacteria. These are manipulated to express the desired gene of interest for the production of commercially important products as medicines etc. For example, two DNA sequences (A and B chains of human insulin) were introduced into the plasmid of E.coli bacteria. This transgenic bacteria now starts producing human insulin chains. Afterwards, these chains were isolated from E.coli and combined so as to form human insulin.

 

Question : What are Cry proteins? Name an organism that produce it. How has man exploited this protein to his benefit?

Solution: Cry proteins are produced by cry gene and these are toxins, responsible for killing insects as lepidopterans (tobacco budworms), coleopterans and dipterans and their larvae . It is secreted by Bacillus thuringiensis. Man exploited gene encoding this toxin, by introducing it into different plant’s genome such as cotton genome with the help of Agrobacterium T-DNA as vector and developed transgenic plants, for e.g., Bt cotton and many other transgenic plants. 

 

Question : What is gene therapy? Illustrate using the example of adenosine deaminase (ADA) deficiency. 

Solution : Gene therapy is the correction of malfunctioning gene by repairing or inserting required normal gene or manipulation of that. ADA (adenosine deaminase deficiency) is a very rare genetic disorder due to deletion of the gene for adenosine deaminase. The enzyme is crucial for the immune system to function. It can be treated by gene therapy. This gene is transfected into early embryonic cells of bone marrow for permanent use. 

 

Question : Can you suggest a method to remove oil (hydrocarbon) from seeds based on your understanding of rDNA technology and chemistry of oil? 

Solution : Recombinant DNA technology (rDNA) is a technique used for manipulating the genetic material of an organism to obtain the desired result. The genes for the formation of oil in the seed should be identified. The appropriate genes should be removed with the help of restriction endonucleases. Such DNA should then be treated with DNA ligases to seal DNA at the broken ends. These cells when grown aseptically on nutrient medium will differentiate into a new plant whose seeds will not have oil in them. 

 

Question : Find out from internet what is golden rice. 

Solution : Golden rice is transgenic plant of rice, Oryza sativa, having gene coding for precursor of pro vitamin A, called as beta carotene. Golden rice was developed by Swiss Federal Institute of Technology, rich in vitamin A (beta carotene), and this fulfills the shortage of dietary vitamin A. The rice grains are golden yellow in colour due to colour it gets from the beta carotene. However, this variety of rice has faced a significant opposition from environmental activities. Therefore, they are still not available in the market for human consumption. 

 

Question : Does our blood have proteases and nucleases? 

Solution : No, blood does not have protease and nuclease. If it would have been there blood and cell would have been digested, some protease does exist in inactive form. 

 

Question : Consult internet and find out how to make orally active & protein pharmaceutical. What is the major problem to be encountered? 

Solution : Orally active protein product that is successfully manufactured is vaccines for prevention of infectious diseases such as hepatitis B, herpes, influenza, etc. Gene for antigen are isolated from bacteria and grown along with cut leaf portions of potato plant in antibiotic medium – followed by callus formation and recombinant / transgenic potato are obtained which contain those vaccines. The problem with the protein pharmaceuticals is that they can be degraded by proteases of digestive system in the alimentary canal. Thus, this is required to protect therapeutic proteins from proteases of digestive system, if taken orally. Orally taken such active protein pharmaceuticals are encapsulated proteins or peptides in liposomes or formulations, which facilitates their delivery also.

 

Chapter 13 : Organisms and Populations

Question : How is diapause different from hibernation? 

Solution : Diapause is a stage of suspended development to cope with unfavorable conditions. Many species of Zooplankton and insects exhibit diapause to tide over adverse climatic conditions during their development. Hibernation or winter sleep is a resting stage where in animals escape winters (cold) by hiding themselves in their shelters. They escape the winter season by entering a state of inactivity by slowing their metabolism. The phenomenon of hibernation is exhibited by bats, squirrels, and other rodents. 

 

Question : If a marine fish is placed in a freshwater aquarium, will the fish be able to survive? Why or why not? 

Solution : If a marine fish is placed in a freshwater aquarium, then its chances of survival will diminish. This is because their bodies are adapted to high salt concentrations of the marine environment. In fresh water conditions, they are unable to regulate the water entering their body (through osmosis). Water enters their body due to the hypotonic environment outside. This results in the swelling up of the body, eventually leading to the death of the marine fish. 

 

Question : Define phenotypic adaptation. Give one example. 

Solution : Phenotypic adaptation involves changes in the body of an organism in response to genetic mutation or certain environmental changes. These responsive adjustments occur in an organism in order to cope with environmental conditions present in their natural habitats. For example, desert plants have thick cuticles and sunken stomata on the surface of their leaves to prevent transpiration. Similarly, elephants have long ears that act as thermoregulators. 

 

Question : Most living organisms cannot survive at temperatures above 45oC. How are some microbes able to live in habitats with temperatures exceeding 100oC?

Solution : Archaebacteria (Thermophiles) are ancient forms of bacteria found in hot water springs and deep sea hydrothermal vents. They are able to survive in high temperatures (which far exceed 100oC) because their bodies have adapted to such environmental conditions. These organisms contain specialized thermo-resistant enzymes, which carry out metabolic functions that do not get destroyed at such high temperatures. 

 

Question : List the attributes that populations but not individuals possess. 

Solution : A population can be defined as a group of individuals of the same species residing in a particular geographical area at a particular time and functioning as a unit. For example, all human beings living at a particular place at a particular time constitute the population of humans. The main attributes or characteristics of a population residing in a given area are:- (a) Birth rate (Natality): It is the ratio of live births in area to the population of an area. It is expressed as the number of individuals added to the population with respect to the members of the population. (b) Death rate (Mortality): It is the ratio of deaths in an area to the population of an area. It is expressed as the loss of individuals with respect to the members of the population. (c) Sex ratio: It is the number of males or females per thousand individuals. (d) Age Distribution: It is the percentage of individuals of different ages in a given population. At any given time, the population is composed of individuals that are present in various age groups. The age distribution pattern is commonly represented through age pyramids. (e) Population density: It is defined as the number of individuals of a population present per unit area at a given time.

 

Question : Name important defense mechanisms in plants against herbivory.

Solution : Several plants have evolved various mechanisms both morphological and chemical to protect themselves against herbivory. (1) Morphological defense mechanisms: (a) Cactus leaves (Opuntia) are modified into sharp spines (thorns) to deter herbivores from feeding on them. (b) Sharp thorns along with leaves are present in Acacia to deter herbivores. (c) In some plants, the margins of their leaves are spiny or have sharp edges that prevent herbivores from feeding on them. (2) Chemical defense mechanisms: (a) All parts of Calotropis weeds contain toxic cardiac glycosides, which can prove to be fatal if ingested by herbivores. (b) Chemical substances such as nicotine, caffeine, quinine, and opium are produced in plants as a part of self-defense. 

 

Question : An orchid plant is growing on the branch of mango tree. How do you describe this interaction between the orchid and the mango tree? 

Solution : An orchid growing on the branch of a mango tree is an epiphyte. Epiphytes are plants growing on other plants which however, do not derive nutrition from them. Therefore, the relationship between a mango tree and an orchid is an example of commensalisms, where one species is benefited while the other remains unaffected. In the above interaction, the orchid is benefited as it gets support while the mango tree remains unaffected. 

 

Question : What is the ecological principle behind the biological control method of managing pest insects?

Solution : The basis of various biological control methods is on the concept of predation. Predation is a biological interaction between the predator and the prey, whereby the predator feeds on the prey. Hence, the predators regulate the population of prey in a habitat, thereby helping in the management of pest insects.

 

Question : Write a short note on (a) Adaptations of desert plants and animals (b) Adaptations of plants to water scarcity (c) Behavioural adaptations in animals (d) Importance of light to plants (e) Effect of temperature or water scarcity and the adaptations of animals. 

Solution: Plants found in deserts are well adapted to cope with harsh desert conditions such as water scarcity and scorching heat. Plants have an extensive root system to tap underground water. They bear thick cuticles and sunken stomata on the surface of their leaves to reduce transpiration. In Opuntia, the leaves are entirely modified into spines and photosynthesis is carried out by green stems. Desert plants have special pathways of synthesize food, called CAM (C4 pathway). It enables the stomata to remain closed during the day to reduce the loss of water through transpiration. 

(ii) Adaptations of desert animals: Animals found in deserts such as desert kangaroo rats, lizards, snakes, etc. are well adapted to their habitat. The kangaroo rat found in the deserts of Arizona never drinks water in its life. It has the ability to concentrate its urine to conserve water. Desert lizards and snakes bask in the sun during early morning and burrow themselves in the sand during afternoons to escape the heat of the day. These adaptations occur in desert animals to prevent the loss of water. 

(b) Adaptations of plants to water scarcity: Plants found in deserts are well adapted to cope with water scarcity and scorching heat of the desert. Plants have an extensive root system to tap underground water. They bear thick cuticles and sunken stomata on the surface of their leaves to reduce transpiration. In Opuntia, the leaves are modified into spines and the process of photosynthesis is carried out by green stems. Desert plants have special pathways to synthesize food, called CAM (C4 pathway). It enables their stomata to remain closed during the day to reduce water loss by transpiration. 

(c) Behavioural adaptations in animals: Certain organisms are affected by temperature variations. These organisms undergo adaptations such as hibernation, aestivation, migration, etc. to escape environmental stress to suit their natural habitat. These adaptations in the behaviour of an organism are called behavioural adaptations. For example, ecothermal animals and certain endotherms exhibit behavioral adaptations. Ectotherms are cold blooded animals such as fish, amphibians, reptiles, etc. Their temperature varies with their surroundings. For example, the desert lizard basks in the sun during early hours when the temperature is quite low. However, as the temperature begins to rise, the lizard burrows itself inside the sand to escape the scorching sun. Similar burrowing strategies are exhibited by other desert animals. Certain endotherms (warm-blooded animals) such as birds and mammals escape cold and hot weather conditions by hibernating during winters and aestivating during summers. They hide themselves in shelters such as caves, burrows, etc. to protect against temperature variations. 

(d) Importance of light to plants Sunlight acts as the ultimate source of energy for plants. Plants are autotrophic organisms, which need light for carrying out the process of photosynthesis. Light also plays an important role in generating photoperiodic responses occurring in plants. Plants respond to changes in intensity of light during various seasons to meet their photoperiodic requirements for flowering. Light also plays an important role in aquatic habitats for vertical distribution of plants in the sea. 

(e) Effects of temperature or water scarcity and the adaptations of animals. Temperature is the most important ecological factor. Average temperature on the Earth varies from one place to another. These variations in temperature affect the distribution of animals on the Earth. Animals that can tolerate a wide range of temperature can called eurythermals. Those which can tolerate a narrow range of temperature are called stenothermal animals. Animals also undergo adaptations to suit their natural habitats. For example, animals found in colder areas have shorter ears and limbs that prevent the loss of heat from their body. Also, animals found in Polar regions have thick layers of fat below their skin and thick coats of fur to prevent the loss of heat. Some organisms exhibit various behavioural changes to suit their natural habitat. These adaptations present in the behaviour of an organism to escape environment stresses are called behavioural adaptations. For example, desert lizards are ectotherms. This means that they do not have a temperature regulatory mechanism to escape temperature variations. These lizards bask in the sun during early hours when the temperature is quite low. As the temperature begins to increase, the lizard burrows itself inside the sand to escape the scorching sun. Similar burrowing strategy is seen in other desert animals. Water scarcity is another factor that forces animals to undergo certain adaptations to suit their natural habitat. Animals found in deserts such as desert kangaroo rats, lizards, snakes, etc. are well adapted to stay in their habitat. The kangaroo rat found in the deserts of Arizona never drinks water in its life. It has the ability to concentrate its urine to conserve water. Desert lizards and snakes bask in the sun during early morning and burrow in the sand as the temperature rises to escape the heat of the day. Such adaptations can be been to prevent the loss of water. 

 

Question : List the various abiotic environmental factors.

Solution : All non-living components of an ecosystem form abiotic components. This comprises factors such as temperature, soil, water and light.

(i) Temperature: It is most ecologically significant environmental factor. It varies seasonally on lands, decreases progressively from the equator towards the poles and from the plains to the mountain tops. It ranges from sub-zero level in polar areas and high altitudes to 50 C in tropical deserts in summer. There are also certain unique habitats such as thermal springs, deep sea hydrothermal vents where the average temperature exceeds 100 C. Organisms which can tolerate and thrive in a wide range of temperatures are called eurythermal e.g. most mammals and birds while organisms which can tolerate a narrow range of temperatures are called stenothermals e.g., polar bears, amphibians.

(ii) Soil: The nature and properties of soil in different places vary significantly. It is dependent mainly on the following factors:

(a) Climate

(b) Weathering process

(c) Soil development process

Water holding capacity and percolation of the soil is determined by its various characteristics,

such as soil composition, grain size and aggregation.

These characteristics of soil along with its pH, mineral composition, topography etc., determine the type of plants that can grow in a particular habitat.

(iii) Water: Life on earth is known to have originated in water and cannot sustain without it.For aquatic organisms, pH, chemical composition and temperature of water is important.

They are also affected by the salinity of the water, which is less than 5 parts per thousand in inland water, 30-35 parts per thousand in sea and 100 parts per thousand in some hypersaline lagoons. Organisms which can tolerate a wide range of salinity are called euryhaline while organisms which can tolerate a narrow range of salinity are called stenohaline. Many fresh water animals cannot live for a long time in sea water because of osmotic problems arising due to high salinity and vice-versa. Plants get the source of energy for preparing their food by photosynthesis and release oxygen during the process. Small shrubs and herbs growing in forests are adapted to photosynthesis under very low light intensities, because they are overshadowed by the tall, canopied trees. Most plants depend on sunlight to meet their photoperiodic requirement for flowering also. Many animals depend upon diurnal and seasonal variations in light intensity as cues for timing their foraging, reproductive and migratory activities. The availability of light on land is closely linked with that of temperature as the sun is the source of both. However, in deep oceans (> 500m), the environment is perpetually dark. The spectral quality of solar radiation is also important for life. The UV component of light is harmful for many organisms. Different components of visible spectrum are available for marine plants living at different depths of the ocean. This is why, different types of algae, i.e., green, brown and red algae occur at different depths in the sea in the upper, middle and deep levels of water respectively.

 

Question : Give an example for: (a) An endothermic animal (b) An ectothermic animal (c) An organism of benthic zone 

Solution : (a) Endothermic animal: Birds such as crows, sparrows, pigeons, cranes, etc. and mammals such as bears, cows, rats, rabbits, etc. are endothermic animals. (b) Ectothermic animal: fish such as sharks, amphibians such as frogs, and reptiles such as tortoises, snakes, and lizards are ectothermic animals. (c) Organism of benthic zone: Decomposing bacteria is an example of an organism found in the benthic zone of a water body. 

 

Chapter 14 : Ecosystem

Question :

Fill in the blanks.

(a) Plants are called as_________ because they fix carbon dioxide.

(b) In an ecosystem dominated by trees, the pyramid (of numbers) is _________ type.

(c) In aquatic ecosystems, the limiting factor for the productivity is _________.

(d) Common detritivores in our ecosystem are_________.

(e) The major reservoir of carbon on earth is_________.

Solution :

(a) Plants are called autotrophs because they fix carbon dioxide.

(b) In an ecosystem dominated by trees, the pyramid (of numbers) is of inverted type.

(c) In aquatic ecosystems, the limiting factor for productivity is light.

(d) Common detritivores in our ecosystem are earthworms.

(e) A major reservoir of carbon on Earth is oceans.

 

Question : Which one of the following has the largest population in a food chain?

(a) Producers

(b) Primary consumers

(c) Secondary consumers

(d) Decomposers

 

Solution : (d) Decomposers

Decomposers include microorganisms such as bacteria and fungi. They form the largest population in a food chain and obtain nutrients by breaking down the remains of dead plants and animals.

 

Question : The second trophic level in a lake is (a) Phytoplankton (b) Zooplankton (c) Benthos (d) Fishes 

Solution : (b) Zooplankton Zooplankton are primary consumers in aquatic food chains that feed upon phytoplankton. Therefore, they are present at the second trophic level in a lake. 

 

Question : Secondary producers are (a) Herbivores (b) Producers (c) Carnivores (d) None of the above 

Solution : (d) None of the above Plants are the only producers. Thus, they are called primary producers. There are no other producers in a food chain. 

 

Question : What is the percentage of photosynthetically active radiation (PAR), in the incident solar radiation. (a) 100% (b) 50 % (c) 1-5% (d) 2-10% 

Solution : (b) 50% Out of total incident solar radiation, about fifty percent of it forms photosynthetically active radiation or PAR. 

 

Question : Describe the components of an ecosystem. 

Solution : An ecosystem is defined as an interacting unit that includes both the biological community as well as the non-living components of an area. The living and nonliving components of an ecosystem interact amongst themselves and function as a unit, which gets evident during the processes of nutrient cycling, energy flow, decomposition, and productivity. There are many ecosystems such as ponds, forests, grasslands, etc. 

The two components of an ecosystem are: 

➢ Biotic component: It is the living component of an ecosystem that includes biotic factors such as producers, consumers, decomposers, etc. Producers include plants and algae. They contain chlorophyll pigment, which helps them carry out the process of photosynthesis in the presence of light. Thus, they are also called converters or transducers. Consumers or heterotrophs are organisms that are directly (primary consumers) or indirectly (secondary and tertiary consumers) dependent on producers for their food. Decomposers include microorganisms such as bacteria and fungi. They form the largest population in a food chain and obtain nutrients by breaking down the remains of dead plants and animals. 

➢ Abiotic component: They are nonliving components of an ecosystem such as light, temperature, water, soil, air, inorganic nutrients, etc. 


 

Question : Define ecological pyramids and describe with examples, pyramids of numbers and biomass. 

Solution : An ecological pyramid is a graphical representation of various ecological parameters such as the number of individuals present at each trophic level, the amount of energy, or the biomass present at each trophic level. Ecological pyramids represent producers at the base, while the apex represents the top-level consumers present in the ecosystem. There are three types of pyramids: ➢ Pyramid of numbers ➢ Pyramid of energy ➢ Pyramid of biomass Pyramid of numbers: It is a graphical representation of the number of individuals present at each trophic level in a food chain of an ecosystem. The pyramid of numbers can be upright or inverted depending on the number of producers. For example, in a grassland ecosystem, the pyramid of numbers is upright. In this type of a food chain, the number of producers (plants) is followed by the number of herbivores (mice), which in turn is followed by the number of secondary consumers (snakes) and tertiary carnivores (eagles). Hence, the number of individuals at the producer level will be the maximum, while the number of individuals present at top carnivores will be least. 

 

Question : What is primary productivity? Give brief description of the factors that affect primary productivity. 

Solution : It is defined as the amount of organic matter or biomass produced by producers per unit area over a period of time. Primary productivity of an ecosystem depends on the variety of environmental factors such as light, temperature, water, precipitation, etc. It also depends on the availability of nutrients and the availability of plants to carry out photosynthesis. 

 

Question : Define decomposition and describe the processes and products of decomposition. 

Solution : Decomposition is the process that involves the breakdown of complex organic matter or biomass from the body of dead plants and animals with the help of decomposers into inorganic raw materials such as carbon dioxide, water, and other nutrients. The various processes involved in decomposition are as follows: ➢ Fragmentation: It is the first step in the process of decomposition. It involves the breakdown of detritus into smaller pieces by the action of detritivores such as earthworms. ➢ Leaching: It is a process where the water-soluble nutrients go down into the soil layers and get locked as unavailable salts. ➢ Catabolism: It is a process in which bacteria and fungi degrade detritus through various enzymes into smaller pieces. ➢ Humification: The next step is humification which leads to the formation of a dark coloured colloidal substance called humus, which acts as a reservoir of nutrients for plants. ➢ Mineralization: The humus is further degraded by the action of microbes, which finally leads to the release of inorganic nutrients into the soil. This process of releasing inorganic nutrients from the humus is known as mineralization. Decomposition produces a dark coloured, nutrient-rich substance called humus. Humus finally degrades and releases inorganic raw materials such as CO2, water, and other nutrient in the soil.

 

Question : Write important features of a sedimentary cycle in an ecosystem. 

Solution :Sedimentary cycles have their reservoirs in the Earth’s crust or rocks. Nutrient elements are found in the sediments of the Earth. Elements such as Sulphur, phosphorus, potassium, and calcium have sedimentary cycles. Sedimentary cycles are very slow. They take a long time to complete their circulation and are considered as less perfect cycles. This is because during recycling, nutrient elements may get locked in the reservoir pool, thereby taking a very long time to come out and continue circulation. Thus, it usually goes out of circulation for a long time. 

 

Question : Outline salient features of carbon cycling in an ecosystem. 

Solution : The carbon cycle is an important gaseous cycle which has its reservoir pool in the atmosphere. All living organisms contain carbon as a major body constituent. Carbon is a fundamental element found in all living forms. All biomolecules such as carbohydrates, lipids, and proteins required for life processes are made of carbon. Carbon is incorporated into living forms through a fundamental process called ‘photosynthesis’. Photosynthesis uses sunlight and atmospheric carbon dioxide to produce a carbon compound called ‘glucose’. This glucose molecule is utilized by other living organisms. Thus, atmospheric carbon is incorporated in living forms. Now, it is necessary to recycle this absorbed carbon dioxide back into the atmosphere to complete the cycle. There are various processes by which carbon is recycled back into the atmosphere in the form of carbon dioxide gas. The process of respiration breaks down glucose molecules to produce carbon dioxide gas. The process of decomposition also releases carbon dioxide from dead bodies of plants and animals into the atmosphere. Combustion of fuels, industrialization, deforestation, volcanic eruptions, and forest fires act as other major sources of carbon dioxide.

 

Chapter 15: Biodiversity and Conservation

Question : Name the three important components of biodiversity. 

Solution : Biodiversity includes variability among life forms from all sources including land, air, and water. Three important components of biodiversity are: (a) Genetic diversity (b) Species diversity (c) Ecosystem diversity.

 

Question : How do ecologists estimate the total number of species present in the world? 

Solution : The total number of species present in the world is calculated by ecologists by statistical comparison between a species richness of a well-studied group of insects of temperate and tropical regions and these ratios are extrapolated with other groups of plants and animals to calculate the total species richness present on the Earth. According to an estimate by researchers, it is about seven million which indicates that the variety of living organisms present on the earth is very vast.

 

Question : What is the significance of the slope of regression in a species-area relationship? 

Solution : The slope of regression (z) has a great significance in order to find a species-area relationship. It gives an estimate of species richness of the area. It is independent of taxonomic category or type of area studied. It has been found that in smaller areas where the species-area relationship is analyzed, the value of the slope of regression is similar regardless of the taxonomic group or the region. However, when a similar analysis is done in larger areas, then the slope of regression is much steeper.

Question : What are the major causes of species loss in a geographical region?

Solution : The major causes of species losses in geographical region are largely due to human activities. They are as: (i) Habitat loss and fragmentation. (ii) Over-exploitation (iii) Alien species Invasions (iv) Co-extinction 

 

Question : How is biodiversity important for ecosystem functioning? 

Solution : An ecosystem with high species diversity is much more stable than an ecosystem with low species diversity. Also, high biodiversity makes the ecosystem more stable in productivity and more resistant towards disturbances such as alien species invasions and flood. If an ecosystem is rich in biodiversity, then the ecological balance would not get affected. As we all know, various trophic levels are connected through food chains. If any one organism or all organisms of any one trophic level is killed, then it will disturb the entire food chain. For example, in a food chain, if all plants are killed, then all deer will die due to the lack of food. If all deer are dead, soon the tigers will also die. Thus, it can be concluded that if an ecosystem is rich in species, then there will be other food alternatives at each trophic level which would not allow any organism to die due to the absence of their food resource. Hence, biodiversity plays an important role in maintaining the health and ecological balance of an ecosystem.

 

Question : What are sacred groves? What is their role in conservation? 

Solution : Sacred groves are tracts of forest which are regenerated around places of worship. Sacred groves are found in Rajasthan, Western Ghats of Karnataka and Maharashtra, Meghalaya, and Madhya Pradesh. Sacred groves help in the protection of many rare, threatened, and endemic species of plants and animals found in an area. The process of deforestation is strictly prohibited in this region by tribals. Hence, the sacred grove biodiversity is a rich area.

 

Question : Can you think of a situation where we deliberately want to make a species extinct? How would you justify it? 

Solution: Yes, there are various kinds of parasites and disease-causing microbes that we deliberately want to eradicate from the Earth. Since these microorganisms are harmful to human beings, scientists are working hard to fight against them. Scientists have been able to eliminate smallpox virus from the world through the use of vaccinations. This shows that humans deliberately want to make these species extinct. Several other eradication programmes such as polio and Hepatitis B vaccinations are aimed to eliminate these disease-causing microbes. Among the ecosystem services are control of floods and soil erosion.

 

Question : How is this achieved by the biotic components of the ecosystem? 

Solution : The biotic components of an ecosystem include living organisms such as plants and animals. Plants play a very important role in controlling floods and soil erosion. The root of plants hold the soil particles together, thereby preventing the top layer of the soil to get eroded by wind or running water. The roots also make the soil porous, thereby allowing ground water infiltration and preventing floods. Hence, plants are able to prevent soil erosion and natural calamities such as floods and droughts. They also increase the fertility of soil and biodiversity. 

 

Question : The species diversity of plants (22 per cent) is much less than that of animals (72 per cent). What could be the explanations to how animals achieved greater diversification? 

Solution : More than 70 percent of species recorded on the Earth are animals and only 22 percent species are plants. There is quite a large difference in their percentage. This is because animals have adapted themselves to ensure their survival in changing environments with comparison to plants. For example, insects and other animals have developed a complex nervous system to control and coordinate their body structure. Also, repeated body segments with paired appendages and external cuticles have made insects versatile and have given them the ability to survive in  various habitats as compared to other life forms.

 

Question : Can you think of a situation where we deliberately want to make a species extinct? How would you justify it?

Solution : Yes, there are various kinds of parasites and disease-causing microbes that we deliberately want to eradicate from the Earth. Since these microorganisms are harmful to human beings, scientists are working hard to fight against them.

Scientists have been able to eliminate smallpox virus from the world through the use of vaccinations. This shows that humans deliberately want to make these species extinct. Several other eradication programmes such as polio and Hepatitis B vaccinations are aimed to eliminate these disease-causing microbes.


Free Job Alert to your Email




  • Dates
  • Results
  • Admit Card
  • Application Form








सरकारी नौकरी अब हिंदी में




FreshersLive - No.1 Job site in India. Here you can find latest 2019 government as well as private job recruitment notifications for different posts vacancies in India. Get top company jobs for both fresher and experienced. Job Seekers can get useful interview tips, resume services & interview Question and answer. Practice online test free which is helpful for interview preparation. Register with us to get latest employment news/rojgar samachar notifications. Also get latest free govt and other sarkari naukri job alerts daily through E-mail.